View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9858_low_45 (Length: 206)
Name: NF9858_low_45
Description: NF9858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9858_low_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 19 - 185
Target Start/End: Original strand, 28732275 - 28732441
Alignment:
| Q |
19 |
ggggtttggagacatagtgtccgctagctctgagcgggatgtcatcattgaggaaaggagagttacagaatgggatgttttgaatagtaggggaaatgaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28732275 |
ggggtttggagacatagtgtccgctagctctgagcgggatgtcattattgaggaaaggagagttacagaatgggatgttttgaatagtaggggaaatgaa |
28732374 |
T |
|
| Q |
119 |
caaagagagttagttcgatactatcaatctcttgggatggactacaacgatgcaaccacggtacgta |
185 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28732375 |
caaagagagttagttcgttactatcaatctcttgggatggagtacaacgatgcaaccacggtacgta |
28732441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University