View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9859_low_5 (Length: 287)

Name: NF9859_low_5
Description: NF9859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9859_low_5
NF9859_low_5
[»] chr8 (2 HSPs)
chr8 (13-272)||(31631193-31631451)
chr8 (79-223)||(31657574-31657717)


Alignment Details
Target: chr8 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 13 - 272
Target Start/End: Complemental strand, 31631451 - 31631193
Alignment:
13 gagaggtggatagtaactactatcattttatgatcatgactcatgaaactgtaagccacatctcagaatatgagtaaacagatatcagttttgcagctgt 112  Q
    ||||||||||||||||| | |||||| ||||  |||||||||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||    
31631451 gagaggtggatagtaacaagtatcatattatcgtcatgactcacgaaactgtaagccacagctcagaatatgaataaacagatatcagttttgcagctgt 31631352  T
113 tgccataatcccaaagatttgcacagactgcacaaggttttaaactacctctccacaaaacatacattttctgactaagtttatgaccttatatgcccag 212  Q
    |||||||||| | ||||||||||||||||||| |||||| |||||||  | |||||||||||| |||||||||||||| |||||||||||||||| ||||    
31631351 tgccataatcgctaagatttgcacagactgcaaaaggttctaaactatgtttccacaaaacattcattttctgactaaatttatgaccttatatgaccag 31631252  T
213 atgaatctatacacaaccgaactttaataaacatgatagtgtgaaagaaatcataaattt 272  Q
     |||||||||| |||||| ||| ||||||||||||||||||  |||||||||||||||||    
31631251 ttgaatctataaacaaccaaac-ttaataaacatgatagtgcaaaagaaatcataaattt 31631193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 79 - 223
Target Start/End: Complemental strand, 31657717 - 31657574
Alignment:
79 aatatgagtaaacagatatcagttttgcagctgttgccataatcccaaagatttgcacagactgcacaaggttttaaactacctctccacaaaacataca 178  Q
    ||||||| |||||||||||||||||| ||  |||||||||||   |||||| ||||| ||| ||||||||| | ||||||||||||||||| ||||| ||    
31657717 aatatgaataaacagatatcagttttccaattgttgccataacttcaaagaattgcaaagattgcacaaggctgtaaactacctctccacacaacatgca 31657618  T
179 ttttctgactaagtttatgaccttatatgcccagatgaatctata 223  Q
    |||||| ||||  || ||||||||||| | |||| ||||||||||    
31657617 ttttctaactacattaatgaccttata-ggccagttgaatctata 31657574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University