View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9859_low_6 (Length: 273)
Name: NF9859_low_6
Description: NF9859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9859_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 28678792 - 28679052
Alignment:
| Q |
1 |
tcaccctgatagtgatttggagtcacaaaccaaacctacagttcctttgattcctagaaacacttcaaaatccgatcgacgcagtccctcatatccacct |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28678792 |
tcaccctgctagtgatttggagtcacaaaccaaacctacagttcctttgattcctagaaacacttcaaaatccgatcgacgcagtccctcatatccacct |
28678891 |
T |
 |
| Q |
101 |
cttccgaaacgccactttccagttagacatactcatccaccaaagaagaaaagaagttgctgctgcaggnnnnnnngttgtaccttcaccatattgctga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28678892 |
cttccgaaacgccactttccagttagacatactcatccaccaaagaagaaaagaagttgctgctgcaggtttttttgttgtaccttcaccatattgctga |
28678991 |
T |
 |
| Q |
201 |
ttcttataattgcaattggcatcactgttggggcactctaccttgcttttaggccaaaact |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28678992 |
ttcttataattgcaattggcatcactgttggggcactctaccttgcttttaggccaaaact |
28679052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University