View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9859_low_7 (Length: 247)
Name: NF9859_low_7
Description: NF9859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9859_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 44892794 - 44892573
Alignment:
| Q |
18 |
tatggaaactttgactctgatttcatttactcaatctcaattaacaacactttcgctaatcataattcctgatttagatcctcctcccaattctgcatag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44892794 |
tatggaaactttgactctgatttcatttactcaatctcaattaacaacactttcgctaatcataattcctgatttagatcctcctcccaattctgcatag |
44892695 |
T |
 |
| Q |
118 |
atctgaaccgttcgggaaaatcaatggtgtcggtcatgtcaatcggtaattttagcttattcttctttttcttaatttatgattagttttctatgtttag |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |||| |
|
|
| T |
44892694 |
atctgaactgttcgggaaaatcaatggtgtcggtcatgtcaatcggtaattttagcttattcttcttttttttaatttatgattagttttgtatg-ttag |
44892596 |
T |
 |
| Q |
218 |
ataaaggaattgaacctttgctt |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44892595 |
ataaaggaattgaacctttgctt |
44892573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University