View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9860_high_8 (Length: 346)
Name: NF9860_high_8
Description: NF9860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9860_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 25 - 329
Target Start/End: Original strand, 33817115 - 33817419
Alignment:
| Q |
25 |
atttggtggcaacatagctttggaagtggatatagccaaagcctttgatacattagaatggagtttgttgattgaagttttaacaaagtttggttttaat |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
33817115 |
atttggtggcaacatagctttggaagtggatatagccaaagcctttgatacattagaatggagttttttgattgaagttttaacaaagtttggttttagt |
33817214 |
T |
|
| Q |
125 |
gcaacttcccgtaattggataaaggccatactggattcagctcacttatctatctctatcaatggtacccaacatggttacttttaagtgtactttaagt |
224 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33817215 |
acaacttcccgtaattggataatggccacactggattcagctcacttatctatctctatcaatggtacccaacatggttacttttaagtgtactttaagt |
33817314 |
T |
|
| Q |
225 |
gtactcgcttttctatcttgcagaagaagtgttgagcaggggcatttctaaaccggtggataatggtgatttagagttgatgtcaagcactagaagctgt |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33817315 |
gtactcgcttttctatcttgcagaagaagtgttgagcacgggcatttctaaactggtggataatggtgatttagagttgatgtcaagcactagaagttgt |
33817414 |
T |
|
| Q |
325 |
gatgt |
329 |
Q |
| |
|
||||| |
|
|
| T |
33817415 |
gatgt |
33817419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University