View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9860_low_19 (Length: 278)
Name: NF9860_low_19
Description: NF9860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9860_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 264
Target Start/End: Complemental strand, 31849198 - 31848953
Alignment:
| Q |
19 |
tttttattttatttttatcattcactagaaaaatacactcaannnnnnnnatagatttacttattttttcctctaatcttatccttccaaaactcttcct |
118 |
Q |
| |
|
||||| |||| |||||||||||||||||||||| |||||||| | ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31849198 |
ttttttttttttttttatcattcactagaaaaacacactcaattttttttaaagatttacttattttttcctctaatctcatccttccaaaactcttcct |
31849099 |
T |
|
| Q |
119 |
ttgtttctcctctaaactttcaaacaaagaccaagagtttattttgtatgagaagaatgcaagagggaagagaggaagtaggaaattatttaaattttag |
218 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31849098 |
ttatttctcctctaaactttcaaacaaaggccaagagtttattttgtatgagaagaatgcaagagggaagagaggaagtaggaaattatttaaattttag |
31848999 |
T |
|
| Q |
219 |
ttatttgatttaaactattggagtagaaggaagggtaacaaattct |
264 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31848998 |
ttatttgttttaaactattggagtagaaggaagggtaacaaattct |
31848953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University