View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9860_low_23 (Length: 245)
Name: NF9860_low_23
Description: NF9860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9860_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 59 - 232
Target Start/End: Complemental strand, 45379297 - 45379124
Alignment:
| Q |
59 |
aaatcttcttgtgttgcnnnnnnnaaaggtctcgttataaaatttgttctagccctctaatgatgttgggtcagccttgattttcattttgttcaattaa |
158 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||| |||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
45379297 |
aaatcttcttgtgttgctttttttaaaggtctcgttaaaaaatttgttttagccctctaatgatgctgggtcagttttgattttcattttgttcaattaa |
45379198 |
T |
|
| Q |
159 |
aataatatcaaggaacgacgttcaaaataaataataaaatacctattcactcaatacaaattagtatatagtct |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45379197 |
aataatatcaaggaacgacgttcaaaataaataataaaatatctattcactcaatacaaattagtatatagtct |
45379124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 45379349 - 45379312
Alignment:
| Q |
1 |
ttgatccaagctcaagccttgaatttagcaaaacctga |
38 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45379349 |
ttgatccaagctcaaaccttgaatttagcaaaacctga |
45379312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University