View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9860_low_24 (Length: 243)
Name: NF9860_low_24
Description: NF9860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9860_low_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 15112965 - 15112857
Alignment:
| Q |
1 |
atatagtaaaccttagcttgagtcgttgtaatcgtactgaaatgctattgtttatcttattactaatagttattattagatgaacgaagtaactacacta |
100 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| |||||||||||||| |||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
15112965 |
atatagtaaaagttagcttgagtcattgtaatcatactgaaatgctatcgtttatcttattactactatttattattagatgaacgaagtaactacacta |
15112866 |
T |
|
| Q |
101 |
ttctcatat |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
15112865 |
ttctcatat |
15112857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University