View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9860_low_30 (Length: 214)
Name: NF9860_low_30
Description: NF9860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9860_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 11 - 197
Target Start/End: Original strand, 15428367 - 15428553
Alignment:
| Q |
11 |
agcagagacatttgaaataagtgaggcacacaagttgttatgatcctcccctcctatttcacacacgatcgctaaacccgctgcagaccaaattgcaaag |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
15428367 |
agcaaagacatttgaaataagtgaggcacacaagttgttatgatcctcccctcctatttcacacacgatcgctaaaccccctgcagaccaaattgcaagg |
15428466 |
T |
|
| Q |
111 |
tttgtcgttgttttgtgagagtgatgattgaatggcataatcataagtgataaaattgtagttattataaaaatgcaaacaatcaat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
15428467 |
tttgtcgttgttttgtgagagtgatgattgaatggcataatcataagtgataaaactgtagttattataaaaatgcaaataatcaat |
15428553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University