View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9860_low_6 (Length: 453)
Name: NF9860_low_6
Description: NF9860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9860_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 292; Significance: 1e-164; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 1 - 346
Target Start/End: Complemental strand, 39148005 - 39147663
Alignment:
| Q |
1 |
accgttggggatgacggtgaggattgtagggaggggcagagagagaattgggttttgaagattttgcatgtgaagaatgtttggaaaggggagcaaggga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
39148005 |
accgttggggatgacggtgaggattgtagggaggggcagagagagaattgggttttgaagattttgcatgtcaagaatgtttggaaaggggaacaaggga |
39147906 |
T |
|
| Q |
101 |
atcatgaaagagaaggaactattgttgagaacgatgaaaataatggtgatgatgatgatcaagtttgtgatacttgcgcggtcgaaaatgatgatgacga |
200 |
Q |
| |
|
||||||||||||||| ||| ||| ||| || |||||||| ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39147905 |
atcatgaaagagaagaaacaattactgataatgatgaaaacaatggtgatgatgat---caagtttgtgatacttgcgcggttgaaaatgatgatgacga |
39147809 |
T |
|
| Q |
201 |
aaaaatagatgattttgaatttgatagaaactcgttttccaaaatgttgaggagggtttctttggctgaagctagattgtatgctcagatgtcacactta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39147808 |
aaaaatagatgattttgaatttgatagaaactcgttttccaaaatgttgaggagggtttctttggctgaagctagattgtatgctcagatgtcacactta |
39147709 |
T |
|
| Q |
301 |
ggaagcttggcctattctataccaaatatcaaggtaaattgattga |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39147708 |
ggaagcttggcctattctataccaaatatcaaggtaaattgattga |
39147663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 409 - 438
Target Start/End: Complemental strand, 39147597 - 39147568
Alignment:
| Q |
409 |
ggatgattcggaatagttaaagatgttttt |
438 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39147597 |
ggatgattcggaatagttaaagatgttttt |
39147568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University