View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9862_high_14 (Length: 250)

Name: NF9862_high_14
Description: NF9862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9862_high_14
NF9862_high_14
[»] chr7 (1 HSPs)
chr7 (98-217)||(4188275-4188394)


Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 98 - 217
Target Start/End: Complemental strand, 4188394 - 4188275
Alignment:
98 caacttttccatattacaacgggaatgagaaatcgttgtcggtactgcataagttactgtacatattcattgcataagttattgcacacatacaacaatg 197  Q
    |||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
4188394 caacttttccatattacaacgggaatgagaaaccgttgtcagtactgcataagttactgcacatattcattgcataagttattgcacacatacaacaatg 4188295  T
198 tcaagcgagtccaccacaca 217  Q
    ||||||||||||||||||||    
4188294 tcaagcgagtccaccacaca 4188275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University