View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9862_high_14 (Length: 250)
Name: NF9862_high_14
Description: NF9862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9862_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 98 - 217
Target Start/End: Complemental strand, 4188394 - 4188275
Alignment:
| Q |
98 |
caacttttccatattacaacgggaatgagaaatcgttgtcggtactgcataagttactgtacatattcattgcataagttattgcacacatacaacaatg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4188394 |
caacttttccatattacaacgggaatgagaaaccgttgtcagtactgcataagttactgcacatattcattgcataagttattgcacacatacaacaatg |
4188295 |
T |
 |
| Q |
198 |
tcaagcgagtccaccacaca |
217 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4188294 |
tcaagcgagtccaccacaca |
4188275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University