View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9862_high_8 (Length: 375)
Name: NF9862_high_8
Description: NF9862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9862_high_8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 16 - 375
Target Start/End: Original strand, 45088537 - 45088895
Alignment:
| Q |
16 |
cttcaagcaattgctttggctgnnnnnnnttatgaagaagtagacatcatgatgaatatggaactcaacattcagtttaagtgcaggcgcattgggcaaa |
115 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45088537 |
cttcaagcaattgctttggctgaaaaaa-ttatgaagaagtagacatcatgatgaatatggaactcaacattcagtttaagtgcaggcgcattgggcaaa |
45088635 |
T |
|
| Q |
116 |
ttctagatctaagggcactcagtttaagggccctcaaaatttcagtttaagggcactcaaaatttcatcaagaaaatgtcctaccataagtttaactgtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45088636 |
ttctagatctaagggcactcagtttaagggccctcaaaatttcagtttaagggcactcaaaatttcatcaagaaaatgtcctaccataagtttaactgtt |
45088735 |
T |
|
| Q |
216 |
aagcaaatatccattacatctcttataaaaacatgtatgaatcaaaagtttttaaggttgaaacgaagccaaagggttaaaatgcaaggtgggataaaac |
315 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45088736 |
aagcaaatctccattacatctcttataaaaacatgtatgaatcaaaagtttttaaggttgaaacgaagccaaagggttaaaatgcaaggtgggataaaac |
45088835 |
T |
|
| Q |
316 |
aaaccaaacatttgagtattaaataatcagccttgctctttatttctttcttctctttct |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45088836 |
aaaccaaacatttgagtattaaataatcagccttgctctttatttctttcttctctttct |
45088895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University