View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9862_high_9 (Length: 287)
Name: NF9862_high_9
Description: NF9862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9862_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 8e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 22 - 157
Target Start/End: Original strand, 4609007 - 4609142
Alignment:
| Q |
22 |
ctgcggatgctgctgtggccgccgcgcaggctgccgtggcagttgtgaggttgacaagtcaaggtagaggtacattgttcagtggaagtagagagaaatg |
121 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4609007 |
ctgctgatgctgctgtggccgccgcacaggctgccgtggcagttgtgaggctgacaagtcaaggtagaggtacattgttcagtggaagtagagagaaatg |
4609106 |
T |
|
| Q |
122 |
ggctgctgtaaagattcaaactttcttcagaggcta |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4609107 |
ggctgctgtaaagattcaaactttcttcagaggcta |
4609142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University