View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9862_low_10 (Length: 283)
Name: NF9862_low_10
Description: NF9862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9862_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 2752934 - 2752665
Alignment:
| Q |
1 |
atccgagggagaaggaatgaaagaaggaaagagaaaaatatcgccattggaaagattagagccaccatgggtgttggaaagtctatcaattctactttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2752934 |
atccgagggagaaggaatgaaagaaggaaagagaaaaatatcgccattggaaagattagagccaccatgggtgttggaaagtctatcaattctactttgg |
2752835 |
T |
 |
| Q |
101 |
gcaaaaataaatgtaacaggatttctccacttacattttg-----atttcatgattattcaattttggtaattttatgatttacgtatgcatgcaagatg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2752834 |
gcaaaaataaatgtaacaggatttctccacttacattttgatttgatttcatgattattcaattttggtaattttatgatttacgtatgcatgcaagatg |
2752735 |
T |
 |
| Q |
196 |
tttaatgttagattcaaagatgtcattatatggattgtcatgccaattttgtagagaaaatggggtaact |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2752734 |
tttaatgttagattcaaagatgtcattatatggattgtcatgccaattttgtagagaaaatggggtaact |
2752665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University