View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9862_low_11 (Length: 260)
Name: NF9862_low_11
Description: NF9862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9862_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 34573219 - 34573462
Alignment:
| Q |
1 |
aattatttgaattctgtttcaccccctattgtatattcttgctaaatattgaagattgcacgtttgattggctttagtggccataagcgtgtattcctta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34573219 |
aattatttgaattctgtttcaccccctattgtatattcttgctacatattgaagattgcacgtttgattggctttagtggccataagcgtgtattcctta |
34573318 |
T |
|
| Q |
101 |
ctctcacgctacagttgattatattaaattttgctacaagaaaaattaggtttcattttccactcgctttacaaaagatagcatgaaatactaatattca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34573319 |
ctctcacgctacagttgattatattaaattttgctacaagaaaaattaggtttcattttccactcgctttacaaaagatagcatgaaatactaatattca |
34573418 |
T |
|
| Q |
201 |
agcatacaaaatgctttcaaaatgactaaagtatattttcaagt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34573419 |
agcatacaaaatgctttcaaaatgactaaaatatattttcaagt |
34573462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University