View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9862_low_13 (Length: 260)
Name: NF9862_low_13
Description: NF9862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9862_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 43746740 - 43746513
Alignment:
| Q |
7 |
tatggaacatatgcaagaggattgtagaagtattttga-----aatgtcacttcttttgtcttatctttctttgagaaagtataaagaagattctttgct |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43746740 |
tatggaacatatgcaagaggattgtagaagtattttgatttgaaatgtcacttcttttgtcttatctttctttgagaaagtataaagaagattctttgct |
43746641 |
T |
 |
| Q |
102 |
taaggctaaatcttccgttcatttttcaagttctacttcaacactagatattactttactttatgtgtaagaccattagggagtactcgtgttacataga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43746640 |
taaggctaaatcttccgttcatttttcaagttctacttcaacactagatattactttactttatgtgtaagaccattagggagttctcgtgttacataga |
43746541 |
T |
 |
| Q |
202 |
tgctgggatatgctgaatatggcatcaa |
229 |
Q |
| |
|
| |||||||||||||||||||||||||| |
|
|
| T |
43746540 |
ttctgggatatgctgaatatggcatcaa |
43746513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University