View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9862_low_19 (Length: 225)
Name: NF9862_low_19
Description: NF9862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9862_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 209
Target Start/End: Original strand, 38069691 - 38069887
Alignment:
| Q |
13 |
gcagagaacagtaactctcttcgacgacgcaattatcgaatatgtgagtggttcttggattaggtccatgagagatcacacaagtatattcctcacaaag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38069691 |
gcagagaacagtaactctcttcgacgacgcaattatcgaatatgtgagtggttcttggattaggtccatgagagatcacacaagtatattcctcacaaag |
38069790 |
T |
|
| Q |
113 |
ctccatctcactcaaagaaagaagtttggaattttttgtatctttggttttggtttgagactcaaatggagaatatataggagatggcatagttggt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38069791 |
ctccatctcactcaaagaaagaagtttggaattttttgtatctttggttttggtttgagactcaaatggagaatatataggagatggcaaagttggt |
38069887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 17 - 128
Target Start/End: Complemental strand, 31876192 - 31876081
Alignment:
| Q |
17 |
agaacagtaactctcttcgacgacgcaattatcgaatatgtgagtggttcttggattaggtccatgagagatcacacaagtatattcctcacaaagctcc |
116 |
Q |
| |
|
|||||||||||| ||||| || || |||||||| ||||| ||||| ||| |||| || ||||||||||| |||||||| || ||||| ||| |||| ||| |
|
|
| T |
31876192 |
agaacagtaactttcttccacaacacaattatcaaatatatgagttgtttttgggtttggtccatgagatatcacacatgtgtattcttcagaaagttcc |
31876093 |
T |
|
| Q |
117 |
atctcactcaaa |
128 |
Q |
| |
|
|||||||||||| |
|
|
| T |
31876092 |
atctcactcaaa |
31876081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University