View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9862_low_2 (Length: 526)
Name: NF9862_low_2
Description: NF9862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9862_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 462; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 462; E-Value: 0
Query Start/End: Original strand, 25 - 516
Target Start/End: Complemental strand, 27062319 - 27061831
Alignment:
| Q |
25 |
tactatataagtgcttaagtaagctgtttatctaaactgggttaattattattattattaatgatgatgttggttttcttttttcaggctgtatactacc |
124 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27062319 |
tactatatcagtgcttatgtaagctgtttatctaaacagggttaattattattatta---atgatgatgttggttttcttttttcaggctgtatactacc |
27062223 |
T |
 |
| Q |
125 |
aaagtaaagatgggaactccacctagggaatttactgttcagattgatactggaagtgacattttgtggattaattgcaatacttgcagtaattgcccta |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27062222 |
aaagtaaagatgggaactccacctagggaatttactgttcagattgatactggaagtgacattttgtggattaattgcaatacttgcagtaattgcccta |
27062123 |
T |
 |
| Q |
225 |
aatctagtggacttggggtcagcatttttcaactttcttgtgattgttttgttgccttggcaaccaaggttctgatttggaacttaattttttgctgttc |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27062122 |
aatctagtggacttggggtcagcatttttcaactttcttgtgattgttttgttgccttggcaaccaaggttctgatttggaacttaattttttgctgttc |
27062023 |
T |
 |
| Q |
325 |
tcttggtacagattgagctcaatttctttgacacagttggttcatccacagctgcgttggttccttgctcggaccccatgtgcgcttctgcgattcaagg |
424 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27062022 |
tcttggtacagattgagctcaatttctttgacacggttggttcatccacagctgcgttggttccttgctcggaccccatgtgcgcttctgcgattcaagg |
27061923 |
T |
 |
| Q |
425 |
tgcggcagctcaatgctcccctcaggttaatcagtgcagctacacctttcagtatgaagatgggagtggtacttccggtgtttatgtctctg |
516 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27061922 |
tgcggcagctcaatgctcccctcaggttaatcagtgcagctacacctttcagtatgaagatgggagtggtacttccggtgtttatgtctctg |
27061831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 161 - 234
Target Start/End: Original strand, 41642943 - 41643016
Alignment:
| Q |
161 |
gttcagattgatactggaagtgacattttgtggattaattgcaatacttgcagtaattgccctaaatctagtgg |
234 |
Q |
| |
|
||||||||||||||||||||||| || || ||| |||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
41642943 |
gttcagattgatactggaagtgatatattatggcttaattgcaatacttgcaataattgccccaaatctagtgg |
41643016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 445 - 503
Target Start/End: Original strand, 41643417 - 41643475
Alignment:
| Q |
445 |
ctcaggttaatcagtgcagctacacctttcagtatgaagatgggagtggtacttccggt |
503 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||| ||||| ||||| || |||||| |
|
|
| T |
41643417 |
ctcaggctaatcagtgcagctacacttttcagtatggggatggaagtgggacgtccggt |
41643475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University