View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9862_low_23 (Length: 214)
Name: NF9862_low_23
Description: NF9862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9862_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 37604291 - 37604092
Alignment:
| Q |
1 |
ctaacgtagactcaattgcctcttaagggattcaaattctctaccatcattacatttttattgtcacatcctaaataagtatattttgttggatcttgat |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |||||| |||||||||||| |
|
|
| T |
37604291 |
ctaaggtagactcaattgcctcttaagggattcaaattctctaccatcattacatttgtattgtcacatcgtaaataagtctatttttttggatcttgat |
37604192 |
T |
 |
| Q |
101 |
cagacgacttaaannnnnnnnnnnnnnnnnaaatatgagtcgtccaaatttcagatcgagagattcagacacactgacttcgtgactgcatagatatttt |
200 |
Q |
| |
|
||||||||| ||| |||||||| ||||||| ||||||||| |||||||||||| | |||||||||||||||||||| ||||||| |
|
|
| T |
37604191 |
cagacgactcaaatttttaatttattttttaaatatgaatcgtccagatttcagattgagagattcagatatactgacttcgtgactgcatatatatttt |
37604092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University