View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9863_high_13 (Length: 409)
Name: NF9863_high_13
Description: NF9863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9863_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 15 - 390
Target Start/End: Original strand, 42148852 - 42149227
Alignment:
| Q |
15 |
gaacctgtgggcagccaccgtcatgtgctctgcttctccaacaattttgggtctgttgagcacaaatatttttcattgtctaatttctattatctcaaga |
114 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42148852 |
gaacctgggggcagccaccgtcatgtgctctgcttctccaacaattttgggtctgttgagcacaaatatttctcattgtctaatttctattatctcaaga |
42148951 |
T |
 |
| Q |
115 |
ggaaaatttatcattcaaatttcacgaaacgctactcatccaaaaccacaaaccttatcctttgtgctctgtgtgctgtttttaggtcaggctctctggg |
214 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42148952 |
ggaaaatttatcatccaaatttcatgaaacgctactcatccaaaaccacaaaccttatcctttgtgctctgtgtgctgtttttaggtcaggctctctggg |
42149051 |
T |
 |
| Q |
215 |
aatagtaagcttcagcttggaacaagcagagttttgctcaacatttacagcctgcaacaggtgaatgtatagagtggatcaggcaaatctctttcacacc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42149052 |
aatagtaagcttcagcttggaacaagcatagttttgctcaacatttacagcctgcaacaggtgaatgtatagagtggatcaggcaaatctctttcacacc |
42149151 |
T |
 |
| Q |
315 |
ttttaaaaaacaagaccctttagaagataggaatcagtctggctattccaatttgaagtttaggtactcaatagag |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42149152 |
ttttaaaaaacaagaccctttagaagataggaatcagtctggctattccaatttgaagtttaggtactcaatagag |
42149227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University