View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9863_high_38 (Length: 255)
Name: NF9863_high_38
Description: NF9863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9863_high_38 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 41 - 255
Target Start/End: Complemental strand, 40455548 - 40455335
Alignment:
| Q |
41 |
aaattaaggacgctataaaaagtttttgaaatgtcatatcatcgtaatgttatcctttcaatttttaaataatctcaaatatataacaaaatattaactt |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40455548 |
aaattaaggacgctataaaaagtttttgaaatgtcatatcatcgtaatgttattctttcaatttttaaataatctcaaatatataacaaaatattaactt |
40455449 |
T |
|
| Q |
141 |
aatcatccaaaactttggatctaagcaagcatacccttaattttgtttgttgtctctcaaatgaggaattgaagtcc---taaatccaaagaggaggatg |
237 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40455448 |
aatcatccaaaactttcgatctaagcaagcatacccttaattt----tgttgtctctcaaatgaggaattgaagtcctaataaatccaaagaggaggatg |
40455353 |
T |
|
| Q |
238 |
ttgtgctttcagtcatac |
255 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
40455352 |
ttgtgctttcagtcatac |
40455335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University