View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9863_high_47 (Length: 241)
Name: NF9863_high_47
Description: NF9863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9863_high_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 43407632 - 43407854
Alignment:
| Q |
1 |
cataccttatttatttccttttttcatttctctttaatttgcgtacttattattctactacgtacgtgttctcctcaactactttaattaatt----aat |
96 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| | |||||| ||| |
|
|
| T |
43407632 |
catacctaatttatttccttgtttcatttctctttaatttccgtacttattattctac---gtacgtgttctcctcaactacttaacttaatttaataat |
43407728 |
T |
 |
| Q |
97 |
tcactctcttcttcattccctttctctaatatatatcttgacatgaatgatatcttctgatctttttatataggaggatctgagaaagaactttaattat |
196 |
Q |
| |
|
| ||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43407729 |
tgactct-tccttcattccctttctctaatatatatcatgacatgaatgatatcttctgatctttttatataggaggatctgagaaacaactttaattat |
43407827 |
T |
 |
| Q |
197 |
aaggatggaatatggtggtgggttagt |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43407828 |
aaggatggaatatggtggtgggttagt |
43407854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University