View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9863_high_52 (Length: 229)
Name: NF9863_high_52
Description: NF9863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9863_high_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 15 - 213
Target Start/End: Original strand, 698350 - 698549
Alignment:
| Q |
15 |
cagagattggaaccttggtaaacttatctgactgatctgttttttgttttcctatgcttttgatcattgagcttagagctttggatagtgtgctttcttg |
114 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
698350 |
cagagattgggaccttggtaaacttagctgactgatctgttttttgttttcctatgcttttgatcattgagcttagagctttggatagtgtgctttcttg |
698449 |
T |
|
| Q |
115 |
tggagtttttggtggccggcgattaatgactgacttcagagg-aatattataggctttggttttctttcctttttatgaactaataggctttggttactg |
213 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
698450 |
tggagtttttggtggccggcaatcaatgactgacttcagaggaaatattataggctttggttttctttcctttttatgaactaataggctttggttactg |
698549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 56 - 110
Target Start/End: Original strand, 665591 - 665644
Alignment:
| Q |
56 |
ttttgttttcctatgcttttgatcattgagcttagagctttggatagtgtgcttt |
110 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
665591 |
ttttgttttc-tatgcttttgttcattgagcttagagctttggatagtgtgcttt |
665644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University