View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9863_high_55 (Length: 223)

Name: NF9863_high_55
Description: NF9863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9863_high_55
NF9863_high_55
[»] chr2 (1 HSPs)
chr2 (13-206)||(2685679-2685872)


Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 2685872 - 2685679
Alignment:
13 cagagatgcaacatgatacagattcaatagttttcaatttttcatcaaaccaacacggtgttaactactcgtttaccatcggaaatccatcgattttttc 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2685872 cagagatgcaacatgatacagattcaatagttttcaatttttcatcaaaccaacacggtgttaactactcgtttaccatcggaaatccatcgattttttc 2685773  T
113 tagactagttgtggattcgggtggtcaacttcaacgtcgaacatggatacaaagtatgaaaacatggacaaatttttggtatgcaccaaaagat 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2685772 tagactagttgtggattcgggtggtcaacttcaacgtcgaacatggatacaaagtatgaaaacatggacaaatttttggtatgcaccaaaagat 2685679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University