View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9863_high_55 (Length: 223)
Name: NF9863_high_55
Description: NF9863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9863_high_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 2685872 - 2685679
Alignment:
| Q |
13 |
cagagatgcaacatgatacagattcaatagttttcaatttttcatcaaaccaacacggtgttaactactcgtttaccatcggaaatccatcgattttttc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2685872 |
cagagatgcaacatgatacagattcaatagttttcaatttttcatcaaaccaacacggtgttaactactcgtttaccatcggaaatccatcgattttttc |
2685773 |
T |
 |
| Q |
113 |
tagactagttgtggattcgggtggtcaacttcaacgtcgaacatggatacaaagtatgaaaacatggacaaatttttggtatgcaccaaaagat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2685772 |
tagactagttgtggattcgggtggtcaacttcaacgtcgaacatggatacaaagtatgaaaacatggacaaatttttggtatgcaccaaaagat |
2685679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University