View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9863_low_18 (Length: 392)
Name: NF9863_low_18
Description: NF9863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9863_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 79 - 308
Target Start/End: Original strand, 32224267 - 32224496
Alignment:
| Q |
79 |
agttgtggttcagaaaaccgaggcgtgtggtttcatggcaggtgttgaagatgagctagggtttgtcaacgtgaaaggagacaacaacaacgggtcgggt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224267 |
agttgtggttcagaaaaccgaggcgtgtggtttcatggcaggtgttgaagatgagctagggtttgtcaacgtgaaaggagacaacaacaacgggtcgggt |
32224366 |
T |
 |
| Q |
179 |
caacggatccatcatgatcatggttttgttgctgctgcatttggaactgttcataggaagaaaaggatggctaggcaaagaagatcttcatcttctacca |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224367 |
caacggatccatcatgatcatggttttgttgctgctgcatttggaactgttcataggaagaaaaggatggctaggcaaagaagatcttcatcttctacca |
32224466 |
T |
 |
| Q |
279 |
tcactattcatctcaaaaatcttccttctt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32224467 |
tcactattcatctcaaaaatcttccttctt |
32224496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 331 - 375
Target Start/End: Original strand, 32224525 - 32224569
Alignment:
| Q |
331 |
ctcgcacgtgccaatctctccaattccacctctttttcattctct |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224525 |
ctcgcacgtgccaatctctccaattccacctctttttcattctct |
32224569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University