View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9863_low_20 (Length: 375)
Name: NF9863_low_20
Description: NF9863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9863_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 11 - 359
Target Start/End: Complemental strand, 5347410 - 5347062
Alignment:
| Q |
11 |
cacagacaccaccacaaaccaacctcacacaaaccctaatccacaaaatcctctcaaacccatcacttcacatttctcacaaactcaatttcttcaattc |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5347410 |
cacaaacaccaccacaaaccaacctcacacaaaccctaatccacaaaatcctctcaaacccatcacttcacatttctcacaaactcaatttcttcaattc |
5347311 |
T |
 |
| Q |
111 |
caacaacaacattcatcattcttcactctcttactcactcattttcaacaatctttgtaaccccaaaacccctttttcactcctccatcaacacctccct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5347310 |
caacaacaacattcatcattcttcactctcttactcactcattttcaacaatctttgtaaccccaaaacccctttttcactcctccatcaacacctccct |
5347211 |
T |
 |
| Q |
211 |
caccttcttcattgcatgaaacaaaatggtattgttttcgattcgaattcgttcaataccctccttaattttcttatcaaatttggtgtttctcataaca |
310 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5347210 |
caccttcttcattccatgaaacaaaatggtattgttttcgattcgaattcgttcaataccctccttaattttcttatcaaatttggtgtttctcataaca |
5347111 |
T |
 |
| Q |
311 |
ataatagtaaaaactttcactttgttattgatattttggattatattca |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5347110 |
ataatagtaaaaactttcactttgttattgatattttggattatattca |
5347062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University