View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9863_low_28 (Length: 336)
Name: NF9863_low_28
Description: NF9863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9863_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 132 - 326
Target Start/End: Original strand, 39479534 - 39479728
Alignment:
| Q |
132 |
ggttcataaaggaagtatgtacttcattaatatcaatgattgctgctgttattatcatgaaacggcttatgaattttgctgcaagtcaggttgtctagtt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39479534 |
ggttcataaaggaagtatgtacttcattaatattaatgattgctgctgttattatcatgaaacagcttatgaattttgctgcaagtcaggttgtctagtt |
39479633 |
T |
 |
| Q |
232 |
ggtaaggagttgactcatactttgtaagagtgtgtgttcaacttctgttgcaggcgtaagaactttgttgctaggttttatgtaagtactctctg |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39479634 |
ggtaaggagttgactcatactttgtaagagtgtgtgttcaacttctgttgcaggcgtaagaactttgttgctaggttttatgtaagtactctctg |
39479728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 63 - 95
Target Start/End: Original strand, 39479465 - 39479497
Alignment:
| Q |
63 |
attctattgtcttgccctgccgtgggcatgtcg |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39479465 |
attctattgtcttgccctgccgtgggcatgtcg |
39479497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University