View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9863_low_31 (Length: 325)
Name: NF9863_low_31
Description: NF9863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9863_low_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 308
Target Start/End: Complemental strand, 9473543 - 9473239
Alignment:
| Q |
1 |
gaaggaagttgaatcgggatcagttgacgaactgaaaaatacttcgcatcaaggaaatggaggactgagaaaacgacgttttgtacctcgaatacacaaa |
100 |
Q |
| |
|
||||||||||||||| |||||| | ||||| ||||| ||| || ||| |||||||||||||||||||||||| | |||||||||| |||||| |||| |
|
|
| T |
9473543 |
gaaggaagttgaatcaggatcaagt---gaactaaaaaacactacgtatcgaggaaatggaggactgagaaaacggcattttgtacctagaatacgcaaa |
9473447 |
T |
 |
| Q |
101 |
tgaaacatatgcctacgatgttgattgttatggccatgatggtttcagtaaaagattattagaagtttttcatacgtaaggttatccgcgaattttttca |
200 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||| || ||||||||| |||||||||||| ||||||||| ||||| ||| |||||||| |
|
|
| T |
9473446 |
tgaaacatatgcctatgaagttgattgttatggccatgatggttttagaaaaagattactagaagtttttcctacgtaaggatatccacgacttttttca |
9473347 |
T |
 |
| Q |
201 |
aacataatcagcatggttggcagctccagaggaaccgaagattgtcgaaaatcctggtatgttgaggttcattcaacaaggcagaatcattgaacaatgt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9473346 |
aacataatcagcatggttggcagctccaggggaaccgaagattgtcgaaaatcctggtatgttgaggttcattcaacaagccagaatcattgaacaatgt |
9473247 |
T |
 |
| Q |
301 |
tagttcct |
308 |
Q |
| |
|
|||||||| |
|
|
| T |
9473246 |
tagttcct |
9473239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 272
Target Start/End: Complemental strand, 9492848 - 9492788
Alignment:
| Q |
212 |
catggttggcagctccagaggaaccgaagattgtcgaaaatcctggtatgttgaggttcat |
272 |
Q |
| |
|
||||||||||||| |||| |||||||||| ||||| ||| | |||||||||||||||||| |
|
|
| T |
9492848 |
catggttggcagcaccaggggaaccgaaggttgtcaaaagttttggtatgttgaggttcat |
9492788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University