View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9863_low_42 (Length: 257)
Name: NF9863_low_42
Description: NF9863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9863_low_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 22 - 239
Target Start/End: Complemental strand, 31679896 - 31679671
Alignment:
| Q |
22 |
ctcactcattcaaccattaagcacaacattaacaatcaattggtcacttt-aaaaattacttaattcaaagctcatgtctacaactatcggaatgactaa |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31679896 |
ctcactcattcaaccattaagcacaacattaacaaccgattggtcactttcaaaaattacttaattcaaagctcatgtctacaactatcggaatgactaa |
31679797 |
T |
|
| Q |
121 |
ttcgaagagcaatatttttattggtttcaagtgtgagtggttaatcatttatgaatgtgtaaaat-----atatatacaaa--agatgactcgtatactt |
213 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
31679796 |
tttgaagagcaatatttttattggtttcaagtgtgaatgattaatcatttatgaatgtgtaaaatgttgaatatatacaaattagatgactcgtatactt |
31679697 |
T |
|
| Q |
214 |
aacatcttaagatttttggctaagat |
239 |
Q |
| |
|
||||||||||| |||||||||||||| |
|
|
| T |
31679696 |
aacatcttaaggtttttggctaagat |
31679671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University