View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9863_low_43 (Length: 255)

Name: NF9863_low_43
Description: NF9863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9863_low_43
NF9863_low_43
[»] chr3 (1 HSPs)
chr3 (130-193)||(25428148-25428211)


Alignment Details
Target: chr3 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 130 - 193
Target Start/End: Complemental strand, 25428211 - 25428148
Alignment:
130 tatcgcgggaaaacgaaatcaacgcgcccatgttttcccgcttaacacaccaactacaaatccc 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25428211 tatcgcgggaaaacgaaatcaacgcgcccatgttttcccgcttaacacaccaactacaaatccc 25428148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University