View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9863_low_45 (Length: 253)
Name: NF9863_low_45
Description: NF9863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9863_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 44624588 - 44624807
Alignment:
| Q |
18 |
ccatggagatggcgccggcggcgacttcggcgatgccagcagtgaggacgatggaagaagtagcattggcgccagagagaccggcagcgagggcgaaagg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44624588 |
ccatggagatggcgccggcggcgacttcggcgatgccagcagtgaggacgatggaagaagtagcattggcgccagagagaccggcggcgagggcgaaagg |
44624687 |
T |
 |
| Q |
118 |
gacggtgaggccatcggaaacgccaatgatgatgtcacggacgatttcacccgcggtgaagtgcttttcagtgtggcgattgagaagactctgtttctca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44624688 |
gacggtgaggccatcggaaacgccaatgatgatgtcacggacgatttcacccgcggtgaagtgcttttcagtgtggcgattgagaaggctctgtttctca |
44624787 |
T |
 |
| Q |
218 |
ggttcaaggtttagtctgtg |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44624788 |
ggttcaaggtttagtctgtg |
44624807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 44635837 - 44636056
Alignment:
| Q |
18 |
ccatggagatggcgccggcggcgacttcggcgatgccagcagtgaggacgatggaagaagtagcattggcgccagagagaccggcagcgagggcgaaagg |
117 |
Q |
| |
|
|||||||||||||||| || || |||||||| ||||| |||||||||| || |||||| | | ||||||||||||||||||||||||| || ||||| || |
|
|
| T |
44635837 |
ccatggagatggcgcctgcagcaacttcggctatgcctgcagtgaggatgacggaagaggcaacattggcgccagagagaccggcagcaagagcgaatgg |
44635936 |
T |
 |
| Q |
118 |
gacggtgaggccatcggaaacgccaatgatgatgtcacggacgatttcacccgcggtgaagtgcttttcagtgtggcgattgagaagactctgtttctca |
217 |
Q |
| |
|
|| ||||| || || || | || || |||||||||||||| || ||||| |||||||| |||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
44635937 |
aacagtgagtccgtcagaggcaccgataatgatgtcacggactatgtcaccggcggtgaaatgctcctcagtgtggttattgagaaggatctgtttctca |
44636036 |
T |
 |
| Q |
218 |
ggttcaaggtttagtctgtg |
237 |
Q |
| |
|
||||||||| |||||||||| |
|
|
| T |
44636037 |
ggttcaagggttagtctgtg |
44636056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University