View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9863_low_45 (Length: 253)

Name: NF9863_low_45
Description: NF9863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9863_low_45
NF9863_low_45
[»] chr8 (2 HSPs)
chr8 (18-237)||(44624588-44624807)
chr8 (18-237)||(44635837-44636056)


Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 44624588 - 44624807
Alignment:
18 ccatggagatggcgccggcggcgacttcggcgatgccagcagtgaggacgatggaagaagtagcattggcgccagagagaccggcagcgagggcgaaagg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
44624588 ccatggagatggcgccggcggcgacttcggcgatgccagcagtgaggacgatggaagaagtagcattggcgccagagagaccggcggcgagggcgaaagg 44624687  T
118 gacggtgaggccatcggaaacgccaatgatgatgtcacggacgatttcacccgcggtgaagtgcttttcagtgtggcgattgagaagactctgtttctca 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
44624688 gacggtgaggccatcggaaacgccaatgatgatgtcacggacgatttcacccgcggtgaagtgcttttcagtgtggcgattgagaaggctctgtttctca 44624787  T
218 ggttcaaggtttagtctgtg 237  Q
    ||||||||||||||||||||    
44624788 ggttcaaggtttagtctgtg 44624807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 44635837 - 44636056
Alignment:
18 ccatggagatggcgccggcggcgacttcggcgatgccagcagtgaggacgatggaagaagtagcattggcgccagagagaccggcagcgagggcgaaagg 117  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||| || |||||| | | ||||||||||||||||||||||||| || ||||| ||    
44635837 ccatggagatggcgcctgcagcaacttcggctatgcctgcagtgaggatgacggaagaggcaacattggcgccagagagaccggcagcaagagcgaatgg 44635936  T
118 gacggtgaggccatcggaaacgccaatgatgatgtcacggacgatttcacccgcggtgaagtgcttttcagtgtggcgattgagaagactctgtttctca 217  Q
     || ||||| || || ||  | || || |||||||||||||| || ||||| |||||||| ||||  |||||||||  |||||||||  |||||||||||    
44635937 aacagtgagtccgtcagaggcaccgataatgatgtcacggactatgtcaccggcggtgaaatgctcctcagtgtggttattgagaaggatctgtttctca 44636036  T
218 ggttcaaggtttagtctgtg 237  Q
    ||||||||| ||||||||||    
44636037 ggttcaagggttagtctgtg 44636056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University