View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9863_low_57 (Length: 238)
Name: NF9863_low_57
Description: NF9863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9863_low_57 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 15 - 229
Target Start/End: Complemental strand, 30405073 - 30404859
Alignment:
| Q |
15 |
agttggtatcgtggaagctcatagacgacaacagatcagttgttggaactcacaactgataaggataatactcaatgtatctcaacggtgcttgtatata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30405073 |
agttggtatcgtggaagctcatagacgacaacagatcagttgttggaactcacaactgataaggataatactcaatgtatctcaacggtgcttgtatata |
30404974 |
T |
|
| Q |
115 |
ttcaatgaactcaatgttcatcaatcatattcaagaaaaaatcataagttgttttcaattattatcacgtcttgtggattgtataagattttacatttgt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30404973 |
ttcaatgaactcaatgttcatcaatcatattcaagaaaaaatcataagttgttttcaattattatcacgtcttgtggattgtataagattttacatttgt |
30404874 |
T |
|
| Q |
215 |
ttgtttcaatatatt |
229 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
30404873 |
ttgtttcaatatatt |
30404859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University