View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9863_low_61 (Length: 229)
Name: NF9863_low_61
Description: NF9863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9863_low_61 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 9496307 - 9496531
Alignment:
| Q |
1 |
ccgtaccgatagaggggacaatcttgctttgtttttgcgtactacttttaattgtcaaattgtcaatttctctaataatcatggtaatgttgatattgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496307 |
ccgtaccgatagaggggacaatcttgctttgtttttgcgtactacttttaattgtcaaattgtcaatttctctaataatcatggtaatgttgatattgtt |
9496406 |
T |
|
| Q |
101 |
gatactacttctgtttgtggaaacttaccagctactagggttaccctaat--gggacataggcgagctgcgtgggatttccttcttcgattgtatagtca |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9496407 |
gatactacttctgtttgtggaaacttaccagctactacggttaccctaatgggggacataggcgagctacgtgggatttccttcttcgattgtatagtca |
9496506 |
T |
|
| Q |
199 |
aattaatgccccttggtgtattttt |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
9496507 |
aattaatgccccttggtgtattttt |
9496531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University