View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9864_high_2 (Length: 390)
Name: NF9864_high_2
Description: NF9864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9864_high_2 |
 |  |
|
| [»] scaffold0186 (1 HSPs) |
 |  |  |
|
| [»] scaffold0164 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (3 HSPs) |
 |  |  |
|
| [»] scaffold0131 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 2e-53; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 18201963 - 18201849
Alignment:
| Q |
1 |
tggaagcgatagagatgacggcggagacggaagcaagtgcgaatgagaggattgagtgcgagatgaaaattttgggggttcggtttagactgattggaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18201963 |
tggaagcgatagagatgacggcggagacggaagcaagtgagaatgagaggattgagtgcgagatgaaaattttgggggttaggtttagactgattggaaa |
18201864 |
T |
 |
| Q |
101 |
aatttgagtgtgaga |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
18201863 |
aatttgagtgtgaga |
18201849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 18202040 - 18201969
Alignment:
| Q |
1 |
tggaagcgatagagatgacggcggagacggaagcaagtgcgaatgagaggattgagtgcgagatgaaaattt |
72 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18202040 |
tggaagcgatagagatgacggtggagacggaagcaagtgcgaatgagaggattgagtgcgagatgaaaattt |
18201969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 249 - 345
Target Start/End: Complemental strand, 9775225 - 9775129
Alignment:
| Q |
249 |
caaacagtcgcaacaactgttgcaaaaatgcattt-gaggccgttatatggtaagggtcgcagatgaagtgtcgtaaaatgcagattttcttgtagtg |
345 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| ||||| ||| || | ||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
9775225 |
caaacagccgcaacaactattgcaaaaatgcattttgaggcggttgtaagttaagggtcgcagatgaagtgtcgcaaaatgcag-ttttcttgtagtg |
9775129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 60 - 115
Target Start/End: Complemental strand, 18201830 - 18201775
Alignment:
| Q |
60 |
gagatgaaaattttgggggttcggtttagactgattggaaaaatttgagtgtgaga |
115 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18201830 |
gagatgaaaattttgggggttaggtttagactgattggaaaaatttgagtgtgaga |
18201775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 237 - 321
Target Start/End: Complemental strand, 27438024 - 27437939
Alignment:
| Q |
237 |
cgacggtttacccaaacagtcgcaacaactgttgcaaaaatgca-tttgaggccgttatatggtaagggtcgcagatgaagtgtcg |
321 |
Q |
| |
|
|||||||| |||| ||||| |||||||||||||||||||||||| |||||||| ||| | ||||||| ||||||||||||||||| |
|
|
| T |
27438024 |
cgacggttcaccctaacagccgcaacaactgttgcaaaaatgcactttgaggcagttgcaaggtaaggatcgcagatgaagtgtcg |
27437939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 68; Significance: 3e-30; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 2272211 - 2272105
Alignment:
| Q |
1 |
tggaagcgatagagatgacggcggagacggaagcaagtgcgaatgagaggattgagtgcgagatgaaaattttgggggttcggtttagactgattggaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | || ||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2272211 |
tggaagcgatagagatgacggcggagacggaagcaaga---agcgataggattgagtgggagatgaaaattttgggggttaggtttagactgattggaaa |
2272115 |
T |
 |
| Q |
101 |
aatttgagtg |
110 |
Q |
| |
|
||| |||||| |
|
|
| T |
2272114 |
aatctgagtg |
2272105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 250 - 346
Target Start/End: Complemental strand, 14958998 - 14958901
Alignment:
| Q |
250 |
aaacagtcgcaacaactgttgcaaaaatgcattt-gaggccgttatatggtaagggtcgcagatgaagtgtcgtaaaatgcagattttcttgtagtgt |
346 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||| ||||| ||| || | ||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
14958998 |
aaacagccgcaacaaccgttgcaaaaatgcattttgaggcagttgtaagttaagggtcgcagatgaagtgtcgcaaaatgcagtttttcttgtagtgt |
14958901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 224 - 352
Target Start/End: Original strand, 33596402 - 33596531
Alignment:
| Q |
224 |
caaagaaaaactacgacggtttacccaaacagtcgcaacaactgttgcaaaaatgcattt-gaggccgttatatggtaagggtcgcagatgaagtgtcgt |
322 |
Q |
| |
|
||||||||| | |||| ||| ||||||||||| |||||||| |||||||| | ||||| ||||| |||||| |||| ||||||||||||||||||| |
|
|
| T |
33596402 |
caaagaaaacttgcgacagttgacccaaacagttgcaacaaccgttgcaaatgttcattttgaggcagttataaggtaggggtcgcagatgaagtgtcac |
33596501 |
T |
 |
| Q |
323 |
aaaatgcagattttcttgtagtgtatggac |
352 |
Q |
| |
|
|| ||| |||||||||||||||| ||||| |
|
|
| T |
33596502 |
aatttgctgattttcttgtagtgtgtggac |
33596531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 8877922 - 8877850
Alignment:
| Q |
249 |
caaacagtcgcaacaactgttgcaaaaatgcatttgaggccgttatatggtaagggtcgcagatgaagtgtcg |
321 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||| | || | |||||||||||||||||||| |
|
|
| T |
8877922 |
caaacagccgcaacaactgttgcaaaaatgcatttgaggcagttgcaaggcatgggtcgcagatgaagtgtcg |
8877850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 2272272 - 2272236
Alignment:
| Q |
1 |
tggaagcgatagagatgacggcggagacggaagcaag |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2272272 |
tggaagcgatagagatgacggcggagacggaagcaag |
2272236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 346 - 383
Target Start/End: Complemental strand, 34551525 - 34551488
Alignment:
| Q |
346 |
tatggacagacaatctcactcattccatgcctatgctt |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34551525 |
tatggacagacaatctcactcattccatgcttatgctt |
34551488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 68; Significance: 3e-30; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 39343698 - 39343592
Alignment:
| Q |
1 |
tggaagcgatagagatgacggcggagacggaagcaagtgcgaatgagaggattgagtgcgagatgaaaattttgggggttcggtttagactgattggaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | || ||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39343698 |
tggaagcgatagagatgacggcggagacggaagcaaga---agcgataggattgagtgggagatgaaaattttgggggttaggtttagactgattggaaa |
39343602 |
T |
 |
| Q |
101 |
aatttgagtg |
110 |
Q |
| |
|
||| |||||| |
|
|
| T |
39343601 |
aatctgagtg |
39343592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 39343759 - 39343723
Alignment:
| Q |
1 |
tggaagcgatagagatgacggcggagacggaagcaag |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39343759 |
tggaagcgatagagatgacggcggagacggaagcaag |
39343723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 68; Significance: 3e-30; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 4009542 - 4009436
Alignment:
| Q |
1 |
tggaagcgatagagatgacggcggagacggaagcaagtgcgaatgagaggattgagtgcgagatgaaaattttgggggttcggtttagactgattggaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | || ||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4009542 |
tggaagcgatagagatgacggcggagacggaagcaaga---agcgataggattgagtgggagatgaaaattttgggggttaggtttagactgattggaaa |
4009446 |
T |
 |
| Q |
101 |
aatttgagtg |
110 |
Q |
| |
|
||| |||||| |
|
|
| T |
4009445 |
aatctgagtg |
4009436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 237 - 346
Target Start/End: Original strand, 21859704 - 21859814
Alignment:
| Q |
237 |
cgacggtttacccaaacagtcgcaacaactgttgcaaaaatgcattt-gaggccgttatatggtaagggtcgcagatgaagtgtcgtaaaatgcagattt |
335 |
Q |
| |
|
|||||||| | | |||||| ||||||||||||||||||||||||||| ||||| ||| || | ||||| ||||||||||||||||| ||||||||| ||| |
|
|
| T |
21859704 |
cgacggttcatcaaaacagccgcaacaactgttgcaaaaatgcattttgaggcagttgtaagttaaggttcgcagatgaagtgtcgcaaaatgcagtttt |
21859803 |
T |
 |
| Q |
336 |
tcttgtagtgt |
346 |
Q |
| |
|
||||||||||| |
|
|
| T |
21859804 |
tcttgtagtgt |
21859814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 251 - 345
Target Start/End: Complemental strand, 22916379 - 22916284
Alignment:
| Q |
251 |
aacagtcgcaacaactgttgcaaaaatgca-tttgaggccgttatatggtaagggtcgcagatgaagtgtcgtaaaatgcagattttcttgtagtg |
345 |
Q |
| |
|
||||||||||||||| ||| |||||||||| |||||| | |||||| |||| ||||||| ||||| |||||| ||| || ||||||||||||||| |
|
|
| T |
22916379 |
aacagtcgcaacaaccgtttcaaaaatgcactttgagacagttataaggtaggggtcgctgatgaggtgtcgcaaattgatgattttcttgtagtg |
22916284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 281 - 345
Target Start/End: Complemental strand, 1390457 - 1390393
Alignment:
| Q |
281 |
tttgaggccgttatatggtaagggtcgcagatgaagtgtcgtaaaatgcagattttcttgtagtg |
345 |
Q |
| |
|
|||||||| |||||| | ||||||||||||||||||||||| || ||||| ||||||||||||| |
|
|
| T |
1390457 |
tttgaggcagttataagttaagggtcgcagatgaagtgtcgcaatttgcagtttttcttgtagtg |
1390393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 4009603 - 4009567
Alignment:
| Q |
1 |
tggaagcgatagagatgacggcggagacggaagcaag |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4009603 |
tggaagcgatagagatgacggcggagacggaagcaag |
4009567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 346 - 385
Target Start/End: Original strand, 27525466 - 27525505
Alignment:
| Q |
346 |
tatggacagacaatctcactcattccatgcctatgcttct |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27525466 |
tatggacagacaatctcactcattccatgcttatgcttct |
27525505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 47 - 88
Target Start/End: Original strand, 37907219 - 37907260
Alignment:
| Q |
47 |
gaggattgagtgcgagatgaaaattttgggggttcggtttag |
88 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
37907219 |
gaggattgagtgggagatgaaaattttgggggttaggtttag |
37907260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 48 - 88
Target Start/End: Original strand, 37907259 - 37907299
Alignment:
| Q |
48 |
aggattgagtgcgagatgaaaattttgggggttcggtttag |
88 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
37907259 |
aggattgagtgggagatgaaaattttgggggttaggtttag |
37907299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 48 - 88
Target Start/End: Original strand, 37907298 - 37907338
Alignment:
| Q |
48 |
aggattgagtgcgagatgaaaattttgggggttcggtttag |
88 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
37907298 |
aggattgagtgggagatgaaaattttgggggttaggtttag |
37907338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 65; Significance: 2e-28; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 237 - 348
Target Start/End: Complemental strand, 48629534 - 48629422
Alignment:
| Q |
237 |
cgacggtttacccaaacagtcgcaacaactgttgcaaaaatgcattt-gaggccgttatatggtaagggtcgcagatgaagtgtcgtaaaatgcagattt |
335 |
Q |
| |
|
|||||||| | | |||||| ||||||||||||||||||||||||||| ||||| ||| || | ||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
48629534 |
cgacggttcatcaaaacagccgcaacaactgttgcaaaaatgcattttgaggcagttgtaagttaagggtcgcagatgaagtgtcgcaaaatgcagtttt |
48629435 |
T |
 |
| Q |
336 |
tcttgtagtgtat |
348 |
Q |
| |
|
||||||||||||| |
|
|
| T |
48629434 |
tcttgtagtgtat |
48629422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 35345150 - 35345044
Alignment:
| Q |
1 |
tggaagcgatagagatgacggcggagacggaagcaagtgcgaatgagaggattgagtgcgagatgaaaattttgggggttcggtttagactgattggaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | || ||||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35345150 |
tggaagcgatagagatgacggcggagacggaagcaaga---agcgataggattgagtgggagatgaaaattttgggggttaagtttagactgattggaaa |
35345054 |
T |
 |
| Q |
101 |
aatttgagtg |
110 |
Q |
| |
|
||| |||||| |
|
|
| T |
35345053 |
aatctgagtg |
35345044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 35345211 - 35345175
Alignment:
| Q |
1 |
tggaagcgatagagatgacggcggagacggaagcaag |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35345211 |
tggaagcgatagagatgacggcggagacggaagcaag |
35345175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 346 - 385
Target Start/End: Original strand, 23109959 - 23109998
Alignment:
| Q |
346 |
tatggacagacaatctcactcattccatgcctatgcttct |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23109959 |
tatggacagacaatctcactcattccatgcttatgcttct |
23109998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 346 - 385
Target Start/End: Original strand, 31076612 - 31076651
Alignment:
| Q |
346 |
tatggacagacaatctcactcattccatgcctatgcttct |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31076612 |
tatggacagacaatctcactcattccatgcttatgcttct |
31076651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 346 - 385
Target Start/End: Original strand, 47195027 - 47195066
Alignment:
| Q |
346 |
tatggacagacaatctcactcattccatgcctatgcttct |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
47195027 |
tatggacagacaatctcactcattccatgcttacgcttct |
47195066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 348 - 385
Target Start/End: Complemental strand, 44083551 - 44083514
Alignment:
| Q |
348 |
tggacagacaatctcactcattccatgcctatgcttct |
385 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
44083551 |
tggacagacaatctcactcattccatgcttatgtttct |
44083514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0186 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: scaffold0186
Description:
Target: scaffold0186; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 249 - 345
Target Start/End: Original strand, 2723 - 2820
Alignment:
| Q |
249 |
caaacagtcgcaacaactgttgcaaaaatgcattt-gaggccgttatatggtaagggtcgcagatgaagtgtcgtaaaatgcagattttcttgtagtg |
345 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||| ||| || | ||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
2723 |
caaacagccgcaacaactgttgcaaaaatgcattttgaggcggttgtaagttaagggtcgcagatgaagtgtcgcaaaatgcagtttttcttgtagtg |
2820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 3e-24; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 237 - 321
Target Start/End: Complemental strand, 4103326 - 4103241
Alignment:
| Q |
237 |
cgacggtttacccaaacagtcgcaacaactgttgcaaaaatgca-tttgaggccgttatatggtaagggtcgcagatgaagtgtcg |
321 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||| |||||||| ||| || ||||||||||||||||||||||||| |
|
|
| T |
4103326 |
cgacggtttaccctaacagccgcaacaactgttgcaaaaatgcactttgaggcagttgtaaggtaagggtcgcagatgaagtgtcg |
4103241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 346 - 385
Target Start/End: Original strand, 49349110 - 49349149
Alignment:
| Q |
346 |
tatggacagacaatctcactcattccatgcctatgcttct |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49349110 |
tatggacagacaatctcactcattccatgcttatgcttct |
49349149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 346 - 386
Target Start/End: Complemental strand, 1807859 - 1807819
Alignment:
| Q |
346 |
tatggacagacaatctcactcattccatgcctatgcttctc |
386 |
Q |
| |
|
|||||||||||||||||||||||| ||| | |||||||||| |
|
|
| T |
1807859 |
tatggacagacaatctcactcatttcatacttatgcttctc |
1807819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0164 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0164
Description:
Target: scaffold0164; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 255 - 346
Target Start/End: Original strand, 29930 - 30021
Alignment:
| Q |
255 |
gtcgcaacaactgttgcaaaaatgcatttgaggccgttatatggtaagggtcgcagatgaagtgtcgtaaaatgcagattttcttgtagtgt |
346 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||| |||| | ||||||||||||| || |||||| ||||||| |||||| ||||||||| |
|
|
| T |
29930 |
gtcgcaacaactgttgcaaatatgcacttgaggcggttaaaaggtaagggtcgcaattgcggtgtcgcaaaatgctgatttttttgtagtgt |
30021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 255 - 348
Target Start/End: Complemental strand, 111091 - 110997
Alignment:
| Q |
255 |
gtcgcaacaactgttgcaaaaatgcat-ttgaggccgttatatggtaagggtcgcagatgaagtgtcgtaaaatgcagattttcttgtagtgtat |
348 |
Q |
| |
|
||||||||||||||||| || ||||| ||||||| |||||| ||||||||||||| || ||||||| ||||||| |||||||||||| ||||| |
|
|
| T |
111091 |
gtcgcaacaactgttgcgaatatgcacattgaggcagttataaggtaagggtcgcaattgcagtgtcgcaaaatgctgattttcttgtattgtat |
110997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 266 - 346
Target Start/End: Original strand, 27513751 - 27513832
Alignment:
| Q |
266 |
tgttgcaaaaatgca-tttgaggccgttatatggtaagggtcgcagatgaagtgtcgtaaaatgcagattttcttgtagtgt |
346 |
Q |
| |
|
||||||||||||||| |||||||| ||| | |||||||||||||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
27513751 |
tgttgcaaaaatgcactttgaggcagttgcaaagtaagggtcgcagatgaagtgtcgcaatttgcagtttttcttgtagtgt |
27513832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 346 - 385
Target Start/End: Original strand, 6756697 - 6756736
Alignment:
| Q |
346 |
tatggacagacaatctcactcattccatgcctatgcttct |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6756697 |
tatggacagacaatctcactcattccatgcttatgcttct |
6756736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 346 - 385
Target Start/End: Original strand, 7126110 - 7126149
Alignment:
| Q |
346 |
tatggacagacaatctcactcattccatgcctatgcttct |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7126110 |
tatggacagacaatctcactcattccatgcttatgcttct |
7126149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 346 - 385
Target Start/End: Original strand, 21812648 - 21812687
Alignment:
| Q |
346 |
tatggacagacaatctcactcattccatgcctatgcttct |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21812648 |
tatggacagacaatctcactcattccatgcttatgcttct |
21812687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000004; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 251 - 345
Target Start/End: Complemental strand, 15327943 - 15327849
Alignment:
| Q |
251 |
aacagtcgcaacaactgttgcaaaaatgca-tttgaggccgttatatggtaagggtcgcagatgaagtgtcgtaaaatgcagattttcttgtagtg |
345 |
Q |
| |
|
||||| |||||||| ||||||||||||||| |||||||| ||| | ||||||||||||||||||||||| || ||||| ||||||||||||| |
|
|
| T |
15327943 |
aacagccgcaacaa-tgttgcaaaaatgcactttgaggcagttgcaaagtaagggtcgcagatgaagtgtcacaatttgcagtttttcttgtagtg |
15327849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 251 - 345
Target Start/End: Complemental strand, 15508312 - 15508218
Alignment:
| Q |
251 |
aacagtcgcaacaactgttgcaaaaatgca-tttgaggccgttatatggtaagggtcgcagatgaagtgtcgtaaaatgcagattttcttgtagtg |
345 |
Q |
| |
|
||||| |||||||| ||||||||||||||| |||||||| ||| | ||||||||||||||||||||||| || ||||| ||||||||||||| |
|
|
| T |
15508312 |
aacagccgcaacaa-tgttgcaaaaatgcactttgaggcagttgcaaagtaagggtcgcagatgaagtgtcacaatttgcagtttttcttgtagtg |
15508218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 346 - 385
Target Start/End: Original strand, 41012015 - 41012054
Alignment:
| Q |
346 |
tatggacagacaatctcactcattccatgcctatgcttct |
385 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
41012015 |
tatggatagacaatctcactcattccatgcttatgcttct |
41012054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 34; Significance: 0.0000000006; HSPs: 3)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 47 - 88
Target Start/End: Complemental strand, 31858 - 31817
Alignment:
| Q |
47 |
gaggattgagtgcgagatgaaaattttgggggttcggtttag |
88 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
31858 |
gaggattgagtgggagatgaaaattttgggggttaggtttag |
31817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 48 - 88
Target Start/End: Complemental strand, 31779 - 31739
Alignment:
| Q |
48 |
aggattgagtgcgagatgaaaattttgggggttcggtttag |
88 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
31779 |
aggattgagtgggagatgaaaattttgggggttaggtttag |
31739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 48 - 88
Target Start/End: Complemental strand, 31818 - 31778
Alignment:
| Q |
48 |
aggattgagtgcgagatgaaaattttgggggttcggtttag |
88 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
31818 |
aggattgagtgggagatgaaaattttgggggttaggtttag |
31778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0131 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0131
Description:
Target: scaffold0131; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 255 - 321
Target Start/End: Complemental strand, 10365 - 10298
Alignment:
| Q |
255 |
gtcgcaacaactgttgcaaaaatgcat-ttgaggccgttatatggtaagggtcgcagatgaagtgtcg |
321 |
Q |
| |
|
|||||| ||||||||||||| |||| ||||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
10365 |
gtcgcagcaactgttgcaaagttgcacattgaggcagttataaggtaagggtcgcaaatgaagtgtcg |
10298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University