View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9864_high_5 (Length: 250)
Name: NF9864_high_5
Description: NF9864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9864_high_5 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 33 - 250
Target Start/End: Complemental strand, 22702266 - 22702055
Alignment:
| Q |
33 |
atcaatgtaccaattacatataaaagggtagctgattcattttgctgttagaatttggtatgataactttgcaaaggaaaatttattaagatgacaatgg |
132 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22702266 |
atcaatgtaccaatta----taaaagggtagctgattcattttgctgttagaatttggtatgataactatgcaaaggaaaatttattaagatgacaatgg |
22702171 |
T |
|
| Q |
133 |
tttgtaatttcctctcttggatgttgttgtcttgctgtgtcttttcttacttttcatggtctcccattcatggtaacaatgtctctttttggtaatccat |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22702170 |
tttgtaatttcctctcttggatgttgttgtcttgctgtgtcttttcttacttttcatggtctcccattcatggtaacaatgtctc--tttggtaatccat |
22702073 |
T |
|
| Q |
233 |
tattagttactgaacatc |
250 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
22702072 |
tattagttactgaacatc |
22702055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University