View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9864_low_12 (Length: 246)
Name: NF9864_low_12
Description: NF9864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9864_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 17860000 - 17860121
Alignment:
| Q |
1 |
tgcacataatggctttcatagattctcaaatcaa-gactggtcttaaagttgaatgctctttgcaaaattgttttgaatcaaagtgtgacccataatgtt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17860000 |
tgcacataatggctttcatagattctcaaatcaaagactggtcttaaagttgaatgctctttgcaaaattgttttgaatcaaagtgtgacccataatgct |
17860099 |
T |
|
| Q |
100 |
aaggatgagggttttggtacaa |
121 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
17860100 |
aaggatgagggttttggtacaa |
17860121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 207 - 236
Target Start/End: Original strand, 17860229 - 17860258
Alignment:
| Q |
207 |
gttgtaattgttacgtttgtatcccctatg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17860229 |
gttgtaattgttacgtttgtatcccctatg |
17860258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University