View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9867_high_10 (Length: 204)

Name: NF9867_high_10
Description: NF9867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9867_high_10
NF9867_high_10
[»] chr6 (1 HSPs)
chr6 (1-188)||(29522203-29522388)
[»] chr5 (1 HSPs)
chr5 (3-111)||(2683473-2683584)


Alignment Details
Target: chr6 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 29522203 - 29522388
Alignment:
1 ataatcatacgtgagttttactatattgtaaaaaacatgtttaaataatttgaattttactttattgtaaaccatatgattgagtgggacgagaaataat 100  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||  ||| ||| |||||||||||||||||||    
29522203 ataagcatacgtgagttttactatattgtaaaaaacatgtttaaataatttgagttttactttattgtaaaaaatacgatggagtgggacgagaaataat 29522302  T
101 ttgatacatagtctatatcatatcatattactataatacatagatccaagagaaattcttgcatagtctcttcctctcgatgaatctc 188  Q
    |||||||||||| ||||||||||||||||||||||||||||||  ||| ||||||||||||||| ||||||  |||||||||||||||    
29522303 ttgatacatagtgtatatcatatcatattactataatacatag--ccatgagaaattcttgcatggtctctcactctcgatgaatctc 29522388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 3 - 111
Target Start/End: Original strand, 2683473 - 2683584
Alignment:
3 aatcatacgtgagttttactatattgtaaaaaacatgtttaaataatttgaattttactttattgtaaaccatatgattga---gtgggacgagaaataa 99  Q
    |||||||||||||||| | ||||| ||||  |||||||||||||||||||| |||| ||||||| | ||  |||  |||||   ||||||  ||||||||    
2683473 aatcatacgtgagtttgattatatcgtaagtaacatgtttaaataatttgagttttcctttattatgaaaaataaaattgattggtgggataagaaataa 2683572  T
100 tttgatacatag 111  Q
    ||||||||||||    
2683573 tttgatacatag 2683584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University