View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9867_low_18 (Length: 229)
Name: NF9867_low_18
Description: NF9867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9867_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 107 - 214
Target Start/End: Complemental strand, 54276458 - 54276351
Alignment:
| Q |
107 |
gtgagttgagtagtctttaactttaagtatgtttttgacatccaattggagaacaagcaagcaaacaatctgaaaaccaaaattacagcaacggtgattg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54276458 |
gtgagttgagtagtctttaactttaagtatgtttttgatatccaattggagaacaagcaagcaaacaatctgaaaaccaaaattacagcaacggtgattg |
54276359 |
T |
 |
| Q |
207 |
agtatttg |
214 |
Q |
| |
|
|||||||| |
|
|
| T |
54276358 |
agtatttg |
54276351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 15 - 58
Target Start/End: Complemental strand, 54276550 - 54276507
Alignment:
| Q |
15 |
ataggttgtgttttagatattgctttaaaggaacgtttgttgga |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54276550 |
ataggttgtgttttagatattgctttaaaggaacgtttgttgga |
54276507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University