View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9868_low_31 (Length: 250)
Name: NF9868_low_31
Description: NF9868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9868_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 124 - 234
Target Start/End: Complemental strand, 39177213 - 39177103
Alignment:
| Q |
124 |
ttaacatgatcaattgccttattactataaacactacagaaaatgggagcaaggaaatctcgacaagaggacgaattgaatccaagccagaggcgtatat |
223 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39177213 |
ttaacatgatcaattgccctattactataaacactacagaaaatgggagcaaggaaatctcgacaagaggacgaattgaatccaagctagaggcgtatat |
39177114 |
T |
|
| Q |
224 |
gcagtataatt |
234 |
Q |
| |
|
||||||||||| |
|
|
| T |
39177113 |
gcagtataatt |
39177103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 125 - 226
Target Start/End: Complemental strand, 39173299 - 39173198
Alignment:
| Q |
125 |
taacatgatcaattgccttattactataaacactacagaaaatgggagcaaggaaatctcgacaagaggacgaattgaatccaagccagaggcgtatatg |
224 |
Q |
| |
|
||||||||| |||| || |||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |||||| |||||| |
|
|
| T |
39173299 |
taacatgatgaatttccatattactataaacactacagaaaatgggaggaaggaaatctcgacaagaagacgaattgaatccaagctagaggcatatatg |
39173200 |
T |
|
| Q |
225 |
ca |
226 |
Q |
| |
|
|| |
|
|
| T |
39173199 |
ca |
39173198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 39177336 - 39177272
Alignment:
| Q |
1 |
agtttagaatgaaaatcgtattattacaataggtgttcaaacttatttacaagatagaatctctc |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39177336 |
agtttagaatgaaaatcgtattattacaataggtgtacaaacttatttacaagatagaatctctc |
39177272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University