View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9868_low_37 (Length: 228)
Name: NF9868_low_37
Description: NF9868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9868_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 31 - 219
Target Start/End: Original strand, 51313039 - 51313227
Alignment:
| Q |
31 |
acaagcgtatgatttatacgaagatcaatctgtaaaatagaaacaacgcaattttgtcaataggcaaatattcaattcaatgacaaatatattacactca |
130 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51313039 |
acaagcgtatgatttacacgaagatcaagctgtaaaatagaaacaacccgattttgtcaataggcaaatattcaattcaatgacaaatatattacactca |
51313138 |
T |
 |
| Q |
131 |
tttcccttgagagatgcttaaactacagtcctctcctctaattgcaagaaatacactcgcatgcccgtagagaaatgaaatgtgctgca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| || |||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
51313139 |
tttcccttgagagatgcttaaactacagtcctctactctaattgtaaaaaatacactcgcatccccttagagaaatgaaatgtgctgca |
51313227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University