View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9868_low_38 (Length: 221)
Name: NF9868_low_38
Description: NF9868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9868_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 11 - 204
Target Start/End: Original strand, 32597567 - 32597766
Alignment:
| Q |
11 |
aagcagagagaaggtactatttgtgtaagttgtgccgaatgtaatggaatttgattctcttcattgtgctattattccattctatgatgagacgaaatga |
110 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32597567 |
aagcagtgataaggtactatttgtgtaagttgtgccgaatgtaatggaatttgattctcttcattgtgctattattccattctatgatgagacgaaatga |
32597666 |
T |
 |
| Q |
111 |
attatatttcatgacataagcaccac------ttgcaaagcaatattatgattttgcaagagattccaaaaagatactacaagctaagagtacttaaaat |
204 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32597667 |
attatatttcatgacataagcaccacttgcaattgcaaagcaatattatgattttgcaagagattccaaaaagatactacaagctaagagtacttaaaat |
32597766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University