View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9869_high_19 (Length: 253)
Name: NF9869_high_19
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9869_high_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 16 - 243
Target Start/End: Original strand, 24755107 - 24755334
Alignment:
| Q |
16 |
cactatcctcattcatcttcccagcaagatcaatcacttcttgaagaggggctactgaattctctagaaatacacttcgagtgttgctcttttctacctc |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24755107 |
cactatcctcattcatcctcccagcaagatcaatcacttcttgaagaggggctactgaattctctagaaatacacttcgagtgttgctcttttctacctc |
24755206 |
T |
|
| Q |
116 |
agacacagaaaccgcggtcttaactgaattagtagaatcttcagcagctgatttactgcaagtctctttgaccgcagccatattggaaggtgaagaatca |
215 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24755207 |
agacacagaagccgcggtcttaactgaattagtagaatcttcagcagctgatttactgccagtctctttgaccgcagccatattggaaggtgaagaatca |
24755306 |
T |
|
| Q |
216 |
tccgatttaacaaactcatcatcctttg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
24755307 |
tccgatttaacaaactcatcatcctttg |
24755334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University