View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9869_high_20 (Length: 250)
Name: NF9869_high_20
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9869_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 20 - 230
Target Start/End: Complemental strand, 7683149 - 7682940
Alignment:
| Q |
20 |
aggcatactttcactaatttatggtgtcgaggaatggtaggaaggttggggttggcggaagttttaagggtcgaggttcgcttcgaagtgatggaaggag |
119 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7683149 |
aggcatactttcacgaatttatggtgtcgaggaatggtaggaaggttggggttggcggaagttttaagg-tcgaggttcgcttcgaagtgatggaaggag |
7683051 |
T |
 |
| Q |
120 |
ttgatgaatttagaggaggatgtgggttggaattggttcaaaaatagggtggtgagaaaggttgataatagtcattttacgagtttttggagggacaaat |
219 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7683050 |
ttgatgaatgtagaggaggatgtgggttggaattggttcaaaaatagggtggtgagaaaggttgataatagtcattttacgagtttttggagggacaaat |
7682951 |
T |
 |
| Q |
220 |
gggttggaaat |
230 |
Q |
| |
|
||||||||||| |
|
|
| T |
7682950 |
gggttggaaat |
7682940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University