View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9869_high_26 (Length: 222)
Name: NF9869_high_26
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9869_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 53298442 - 53298661
Alignment:
| Q |
1 |
taaataggctttgagttgtaaatgggttgagtacctcacgtaatcttatttctaattgaaatatctttgcagtgataaaaattaataaatcaaataaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53298442 |
taaataggctttgagttgtaaatgggttgagtacctcacgtaatcttatttctaattgaaatatctttgcagtgataaaaattaataaatcaaataaata |
53298541 |
T |
 |
| Q |
101 |
ttcattagt----acccaccatttgaaaaacatgagatttgtgaacttttatttaaagcttgttgttgggtgtgcattttaggtcaatgtagtgctcatt |
196 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
53298542 |
ttcattagtacccacccaccatttgaaaaacatgagatttttttacttttatttaaagcttgttgtggggtgtgcattttaggtcaatgtagtgctcatt |
53298641 |
T |
 |
| Q |
197 |
taatttcgaaatagttcttc |
216 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
53298642 |
taatttcgaaatatttcttc |
53298661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University