View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9869_high_27 (Length: 220)
Name: NF9869_high_27
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9869_high_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 45709461 - 45709255
Alignment:
| Q |
1 |
tctttgggatttcttcaaactctcttttgcttctggagttatgctatggtacgttatgacaatctctat----ctcttaatacatgatcatattaagtta |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45709461 |
tctttgggatttcttcaaactctcttttgcttctggagttatgctatggtacgttatgacaatctctatatatctcttaatacatgatcatattaagtta |
45709362 |
T |
|
| Q |
97 |
atgtctagagcctaaatcacgtacgtgcatgtgatgtgatgtgacacaaaattaaatttgtatttcttgaaaggaaaaccttggtgtgcaagtaatatac |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45709361 |
atgtctagagcctaaatcacgtacgtgcatgtgatgtga-----cacaaaattaaatttatatttcttgaaaggaaaaccttggtgtgcaagtaatatac |
45709267 |
T |
|
| Q |
197 |
tcctactgatgt |
208 |
Q |
| |
|
||||||| |||| |
|
|
| T |
45709266 |
tcctacttatgt |
45709255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University