View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9869_low_2 (Length: 694)
Name: NF9869_low_2
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9869_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 641; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 641; E-Value: 0
Query Start/End: Original strand, 16 - 689
Target Start/End: Complemental strand, 45710111 - 45709428
Alignment:
| Q |
16 |
caattattttatgcatgtactcaatgatatgttagtgcgtcaattaataaatatgacaactttatatcgttaatgtatagtaattaaactcttgatggtc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45710111 |
caattattttatgcatgtactcaatgatatgttagtgcgtcaattaataaatatgacaactttatatcgttaatgtatagtaattaaactcttgatggtc |
45710012 |
T |
|
| Q |
116 |
ctatcttgcttaacttgtgtgttt----------gtggtttttatgatggagctagttggggatggcaagcgcattggagacactttgtgggcaagcttt |
205 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45710011 |
ctatcttgcttaacttgtgtgttttcgtgtgtttgtggtttttatgatggagctagttggggatggcaagcgcattggagacactttgtgggcaagcttt |
45709912 |
T |
|
| Q |
206 |
tggggcaaagaaacataacttattaggaatatacctacaaagatcttggattgttctgttcctttgttgttttttactgttgccgttttatatctttgcc |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45709911 |
tggggcaaagaaacataacttattaggaatatacctacaaagatcttggattgttctgttcctttgttgttttttactgttgccgttttatatctttgcc |
45709812 |
T |
|
| Q |
306 |
actccaattctcaaacttctaggacaacctgatgacgtggcagaatggagtggtattgtggctatctggcttatacctttgcatttcagttttgcatttc |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45709811 |
actccaattctcaaacttctaggacaacctgatgacgtggcagaatggagtggtattgtggctatctggcttatacctttgcatttcagttttgcatttc |
45709712 |
T |
|
| Q |
406 |
agtttcctcttcagaggtttctacaatgccagctgaaaacaggtgtgattgcttgggtttctttggttggtttggtggtaaatgtggtgcttagttggct |
505 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45709711 |
agtttcctcttcagaggtttctacaatgccagctgaaaactggtgtgattgcttgggtttctttggttggtttggtggtaaatgtggtgcttagttggct |
45709612 |
T |
|
| Q |
506 |
gttgatttttgtttgggattttggacttattggtgctgctattgctttggatgtttcttggtggattttggtttttgggatgttggcttatactgtttgt |
605 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45709611 |
gttgatttttgtttgggattttggacttattggtgctgctattgctttggatgtttcttggtggattttggtttttgggatgttggcttatactgtttgt |
45709512 |
T |
|
| Q |
606 |
ggtgggtgtcctttaacttggactggtttttcaattgaagccttttctggtctttgggatttcttcaaactctcctttgcttct |
689 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45709511 |
ggtgggtgtcctttaacttggactggtttttcaattgaagccttttctggtctttgggatttcttcaaactctcttttgcttct |
45709428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 250
Target Start/End: Complemental strand, 29112251 - 29112164
Alignment:
| Q |
163 |
tggggatggcaagcgcattggagacactttgtgggcaagcttttggggcaaagaaacataacttattaggaatatacctacaaagatc |
250 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| |||||||| || ||| ||||| || | |||||||||||| | |||||||| |
|
|
| T |
29112251 |
tggggatgggaagcgcattggagacactatgtggacaagctttcggagcagggaaactagacatgttaggaatatacatgcaaagatc |
29112164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 6588342 - 6588294
Alignment:
| Q |
160 |
agttggggatggcaagcgcattggagacactttgtgggcaagcttttgg |
208 |
Q |
| |
|
||||||| |||| ||| |||||||||||||| ||||||||||| ||||| |
|
|
| T |
6588342 |
agttgggtatgggaagtgcattggagacactatgtgggcaagcatttgg |
6588294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University