View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9869_low_33 (Length: 303)
Name: NF9869_low_33
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9869_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 52728161 - 52727893
Alignment:
| Q |
1 |
aatattatcgttgaatttgacccatgaacatcaaaataataacataaatcaagtgacttctgaaatagtcgcgagtataaattgttatatgactgttaaa |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52728161 |
aatattatcattgaatttgacccatgaacatcaaaataataacataaatcaagtgacttctgaaatagtcgcgagtataaattgttatatgactgttaaa |
52728062 |
T |
 |
| Q |
101 |
actttcaaacttgaccgtttaagtaatggttacatgtcaagatttacccctcattcagaacttcatagtatcatcacatccaatgttgaaatactctttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52728061 |
actttcaaacttgaccgtttaagtaatggttacatgtcaagatttacccctcattcagaacttcatagtatcatcacatccaatgttgaaatactctttc |
52727962 |
T |
 |
| Q |
201 |
agaaagataaaactttcaatcttgatgataattaagcatggtcacatgtcaagatttacccctcataaa |
269 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52727961 |
agaaagataaaactttcaatcttgacgataattaagcatggtcacatgtcaagatttacccctcataaa |
52727893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University