View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9869_low_34 (Length: 299)
Name: NF9869_low_34
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9869_low_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 55171320 - 55171041
Alignment:
| Q |
1 |
tacattacagagaacagtcctgccaatgtcaattcttggggatctaagaacggagaatttcgttctgttggcaaaaattctggaccacaagcttcactga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55171320 |
tacattacagagaacagtcctgccaatgtcaattcttggggatctaagaacggagaatttcgttctgttggcaaaaattctggaccacaagcttcactga |
55171221 |
T |
|
| Q |
101 |
aatgtcccagcggaaaaaagattgttgctgtcgagtttgcaagctttggtaatcctagtggttactgtggagattttgctattggaaattgtaacggtgg |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
55171220 |
aatgtcccagcggcaaaaagattgttgctgtcgagtttgcaagctttggtaatcctagtggttactgtggagattttgctcttggaaattgtaacggtgg |
55171121 |
T |
|
| Q |
201 |
tgctgctaagggtgttgttgagaaggcatgcttggggaaagaagaatgtttggttgaagtgaaccgtgcaaacttcaacg |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55171120 |
tgctgctaagggtgttgttgagaaggcatgcttggggaaagaagaatgtttggttgaagtgaaccgtgcaaacttcaacg |
55171041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University