View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9869_low_38 (Length: 278)

Name: NF9869_low_38
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9869_low_38
NF9869_low_38
[»] chr8 (1 HSPs)
chr8 (96-267)||(16807030-16807201)


Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 96 - 267
Target Start/End: Original strand, 16807030 - 16807201
Alignment:
96 gtcatcactgcgtttgttatcgcttaatttctaaggttgtttattcttcacggcttcagcttccaaccgcttctcctcgtagttcattcatgtaattggg 195  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      
16807030 gtcatcactgcatttgttatcgcttaatttctaaggttgtttattcttcacggcttcagcttccaaccgcttctcctcgtagttcattcatgtaattgat 16807129  T
196 cttcttgagtactaactcttctttgaacttatagttgttttcatagacgaagcacttcaacttatcgttcat 267  Q
    ||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16807130 cttgttgagtcctaactcttctttgaacttatagttgttttcatagacgaagcacttcaacttatcgttcat 16807201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University