View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9869_low_41 (Length: 257)
Name: NF9869_low_41
Description: NF9869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9869_low_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 19 - 141
Target Start/End: Complemental strand, 11199143 - 11199018
Alignment:
| Q |
19 |
ttagtaggcatagaatcaagatggtcacgtgcaaattggaaagcatgtttctgcaaaggaagagacatgtcacaagctttgacatgaatgctgtt---gt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
11199143 |
ttagtaggcatagaatcaagatggtcacgtgcaaattggaaagcatgtttctgcaaaggaagagacatgtcacaagctttgacatgaatgctgttgttgt |
11199044 |
T |
|
| Q |
116 |
tgagtttaatattatttttataatca |
141 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
11199043 |
tgagtttaatattatttttataatca |
11199018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 205 - 252
Target Start/End: Complemental strand, 11198954 - 11198907
Alignment:
| Q |
205 |
atcaaactgtttagaaacttgctccttctctctaactccttctctgct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11198954 |
atcaaactgtttagaaacttgctccttctctctaactccttctctgct |
11198907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University